File size: 7,243 Bytes
7f5a0c1 | 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 | """
Very hard benchmark dataset for FluxEM + Qwen3-4B tool calling.
These prompts push tool parsing and computation while staying within
supported domains and formats.
"""
from typing import Dict, List, Any
VERY_HARD_BENCHMARK_PROMPTS: Dict[str, List[Dict[str, Any]]] = {
"arithmetic": [
{
"prompt": "Compute ((987654321 - 123456789) * (54321 + 98765) + 7^9) / 13",
"expected": 10176660287489.154,
"description": "Large nested arithmetic with exponent",
},
{
"prompt": "Evaluate (1.2345^6 * 10^5) - (98765 / 3)",
"expected": 321032.12224199565,
"description": "Decimal exponent and division",
},
{
"prompt": "Compute ((2^30) + (3^20) - (5^12)) / 17",
"expected": 253905035.29411766,
"description": "Large powers with subtraction",
},
],
"physics": [
{
"prompt": "Convert 88 ft/s to m/s",
"expected": 26.82239870320391,
"description": "Imperial to SI speed conversion",
},
{
"prompt": "Convert 0.75 MPa to kPa",
"expected": 750.0000719447362,
"description": "Metric prefix conversion",
},
{
"prompt": "What are the dimensions of Wb?",
"expected": {"M": 1.0, "L": 2.0, "T": -2.0, "I": -1.0, "Theta": 0.0, "N": 0.0, "J": 0.0},
"description": "Derived unit dimensions",
},
],
"chemistry": [
{
"prompt": "What is the molecular weight of Ca3(PO4)2?",
"expected": 310.18,
"description": "Complex ionic compound",
},
{
"prompt": "What is the molecular weight of C6H4(OH)2?",
"expected": 110.108,
"description": "Nested parentheses formula",
},
{
"prompt": "What is the molecular formula of caffeine?",
"expected": "C8H10N4O2",
"description": "Formula lookup",
},
],
"biology": [
{
"prompt": "What's the GC content of ATGCGTACGATCGGATCCGATCGTAGCTAGC?",
"expected": 0.5483870967741935,
"description": "Long GC content",
},
{
"prompt": "What's the molecular weight of GATTACAGATTACAGATTACA?",
"expected": 6499.2,
"description": "Long DNA molecular weight",
},
{
"prompt": "What's the GC content of the reverse complement of AAGGTTCCGGAATTCCGGAA?",
"expected": 0.5,
"description": "Reverse complement GC content",
},
],
"math": [
{
"prompt": "What is the dot product of [3, -1, 4, 1, 5, -9, 2, 6] and [2, 7, 1, 8, 2, 8, 1, 8]?",
"expected": -1.0,
"description": "8D dot product",
},
{
"prompt": "Calculate the determinant of [[4, 2, 0, 1], [3, 5, 1, 2], [2, 0, 3, 4], [1, 2, 4, 0]]",
"expected": -229.0,
"description": "4x4 determinant",
},
{
"prompt": "Normalize the vector [5, -3, 2, -6]",
"expected": [0.581238, -0.348743, 0.232495, -0.697486],
"description": "Vector normalization",
},
],
"music": [
{
"prompt": "What is the prime form of [0, 1, 4, 6, 7, 9, 10]?",
"expected": [0, 1, 4, 6, 7, 9, 10],
"description": "Prime form heptachord",
},
{
"prompt": "What is the normal form of [2, 5, 7, 8, 11, 0]?",
"expected": [0, 2, 5, 7, 8, 11],
"description": "Normal form hexachord",
},
{
"prompt": "Transpose [1, 4, 8] by -7 semitones",
"expected": [6, 9, 1],
"description": "Negative transposition",
},
],
"geometry": [
{
"prompt": "What's the distance between [-8.5, 3.25] and [4.75, -6.5]?",
"expected": 16.450683876362103,
"description": "Distance with decimals",
},
{
"prompt": "Rotate [7, -2] by 225 degrees",
"expected": [-6.3639610306789285, -3.5355339059327364],
"description": "Rotation in degrees",
},
{
"prompt": "Find the midpoint of [-12, 9] and [5, -3]",
"expected": [-3.5, 3.0],
"description": "Midpoint with negatives",
},
],
"graphs": [
{
"prompt": "What's the shortest path from node 0 to node 6 in Graph(nodes={0,1,2,3,4,5,6}, edges=[(0,1),(1,2),(2,6),(0,3),(3,4),(4,5),(5,6),(1,4)])?",
"expected": {"path": [0, 1, 2, 6], "distance": 3},
"description": "Shortest path with multiple routes",
},
{
"prompt": "Is this graph connected: Graph(nodes={0,1,2,3,4,5}, edges=[(0,1),(1,2),(3,4)])?",
"expected": False,
"description": "Disconnected graph",
},
{
"prompt": "Is Graph(nodes={0,1,2,3,4}, edges=[(0,1),(1,2),(2,3),(3,4),(4,1)]) a tree?",
"expected": False,
"description": "Cycle tree check",
},
],
"sets": [
{
"prompt": "What is the union of {-10, -5, 0, 5, 10} and {-5, -3, 2, 5, 7}?",
"expected": [-10, -5, -3, 0, 2, 5, 7, 10],
"description": "Union with negatives",
},
{
"prompt": "What is the intersection of {1, 2, 3, 5, 8, 13, 21} and {3, 5, 7, 11, 13, 17, 19}?",
"expected": [3, 5, 13],
"description": "Intersection of larger sets",
},
{
"prompt": "What is the complement of {2, 3, 5, 7} relative to {1, 2, 3, 4, 5, 6, 7, 8, 9, 10}?",
"expected": [1, 4, 6, 8, 9, 10],
"description": "Complement with larger universe",
},
],
"logic": [
{
"prompt": "Is 'p or not p' a tautology?",
"expected": True,
"description": "Basic tautology",
},
{
"prompt": "Is 'p -> p' a tautology?",
"expected": True,
"description": "Implication tautology",
},
{
"prompt": "Are '(p and q) and (not p and not q)' logically equivalent?",
"expected": True,
"description": "Equivalence keyword",
},
],
"number_theory": [
{
"prompt": "Is 99991 prime?",
"expected": True,
"description": "Large prime check",
},
{
"prompt": "What is 13^123 mod 997?",
"expected": 310,
"description": "Large modular exponent",
},
{
"prompt": "Find the 2000th prime number",
"expected": 17389,
"description": "Nth prime",
},
],
}
def count_prompts() -> int:
"""Count total number of test prompts."""
return sum(len(prompts) for prompts in VERY_HARD_BENCHMARK_PROMPTS.values())
def get_domain_summary() -> Dict[str, int]:
"""Get summary statistics per domain."""
return {domain: len(prompts) for domain, prompts in VERY_HARD_BENCHMARK_PROMPTS.items()}
|